non targeting control sequence  (Addgene inc)

Journal: Nature Communications

Article Title: Lysosomal lipid peroxidation contributes to ferroptosis induction via lysosomal membrane permeabilization

doi: 10.1038/s41467-025-58909-w

Figure Lengend Snippet: a In vivo growth of subcutaneous GPX4 KO H460 xenografts in Balb/c-nu mice. Five days after transplantation, mice were treated randomly with vehicle or CQ (25 mg/kg intraperitoneally daily). The distribution of tumor volume is shown. b Tumor weight at the end of the experiment. Data for panel ( a , b ) are mean ± s.d., n = 9 (vehicle), n = 10 (CQ) independent experiments, p values were calculated by two-way ANOVA with Sidak’s multiple comparison test ( a ) or by the two-tailed unpaired t test ( b ). c 4-HNE accumulation in the group subjected to CQ treatment on tumor of GPX4 KO cells. Representative 4-HNE immunostaining images of four different tumor samples and the relative intensity normalized to vehicle group of WT H460 tumor are shown. Scale bar, 40 µm. Data are mean ± s.d., n = 4 independent experiments, p values were calculated by the two-tailed unpaired t test. d Model illustrating the mechanism of cell death initiated by lysosomal LPO. Purple closed circles represent lipid radicals. Created in BioRender. Yuma, S. (2025) https://BioRender.com/c82c186 . Source data are provided as a Source Data file.

Article Snippet: The single guide RNA (sgRNA) sequence targeting GPX4 was 5′-CTTGGCGGAAAACTCGTGCA-3′, referring to a previous study . sgRNA was cloned into BsmbI-digested lentiCRISPR v2-Blast vectors (Addgene, 83480).

Techniques: In Vivo, Transplantation Assay, Comparison, Two Tailed Test, Immunostaining

Journal: bioRxiv

Article Title: Increased mRNA translation delays lung adenocarcinoma initiation and exposes a therapeutic vulnerability to MEK inhibitors

doi: 10.1101/2025.03.19.644135

Figure Lengend Snippet: (A-E) Ad5-SPC-CRE was administered intranasally to KRAS LSL-G12D/WT ; Rosa26 LSL-MYC/LSL-MYC mice that were either eIF4A2 WT/WT , or eIF4A2 fl/fl at a titre (1 × 10 8 plaque forming units (pfu)/mouse) sufficient to evoke recombination in ≈5% alveolar type II cells ( A ; Day 0). Mice were sacrificed at the indicated time points (B, C) or at clinical endpoint (E) and lungs removed and fixed. Mutant KRAS G12D and eIF4A2 were visualised using immunofluorescence (B) and lung tumour burden determined by H&E staining (C, E) . In D , Ad5-SPC-CRE was administered to Kras LSL-G12D/WT ; Rosa26 LSL-MYC/LSL-MYC ; Hprt LSL-iRFP ; mice that were either eIF4A2 WT/WT or eIF4A2 fl/fl and lung tumour progression was monitored by whole body iRFP imaging. In (B,C) bars are mean ± SEM, each point represents an individual mouse, and statistical test is unpaired t-test. In (D) graph represents mean ± SD, 2 individual mice per point. The statistical test for the Kaplan-Maier analysis in (E) is Logrank (Mantel-Cox) and cohort sizes were N=13 individual mice for eIF4A2 wt/wt (WT) and N=11 for eIF4A2 fl/fl . (F-H) Kras LSL-G12D/WT ; Rosa26 LSL-MYC/LSL-MYC mice that were either eIF4A2 WT/WT , or eIF4A2 fl/fl were induced with Ad5-SPC-CRE as for (A) . Mice were sacrificed 56 days (F, G) following induction or at clinical endpoint (H) and lungs removed and fixed. p21 was visualised in the extra-tumoral regions of the lung and in lung tumours using immunohistochemistry (F, H) , and KRAS G12D and p21 were visualised using immunofluorescence (G) . bars are mean ± SEM, each point represents quantification from an individual mouse, statistical test is unpaired t-test.

Article Snippet: Guide RNA (gRNA) sequences targeting Eif4a2 were cloned into a lentiCRISPR vector (Addgene 52961). gRNAs were as follows: eIF4A2 (forward) CACCGGAAGCCCCTCACATTGTTGT; eIF4A2 (reverse) AAACACAACAATGTGAGGGGCTTCC.

Techniques: Mutagenesis, Immunofluorescence, Staining, Imaging, Immunohistochemistry

Journal: bioRxiv

Article Title: Increased mRNA translation delays lung adenocarcinoma initiation and exposes a therapeutic vulnerability to MEK inhibitors

doi: 10.1101/2025.03.19.644135

Figure Lengend Snippet: (A) Ad5-SPC-CRE was administered intranasally to KRAS LSL-G12D/WT ; Rosa26 LSL-MYC/LSL-MYC (KM) mice at a titre (1 × 10 8 plaque forming units (pfu)/mouse) sufficient to evoke recombination in ≈5% alveolar type II cells. Some mice were left uninduced (healthy). Mice were sacrificed at the indicated time points and lungs removed and fixed. Tumour burden was visualised using H&E and phospho-ERK by immunohistochemistry. (B) KRAS LSL-G12D/WT ; eIF4A2 WT/WT or KRAS LSL-G12D/WT ; eIF4A2 fl/fl mice were induced with Ad5-SPC-CRE as for (A). Mice were sacrificed at clinical endpoint or, in the case of several animals from the KRAS LSL-G12D/WT ; eIF4A2 fl/fl cohort at 375 days following induction with Ad5-SPC-CRE. The H&E images display the tumour burden of a KRAS LSL-G12D/WT ; eIF4A2 WT/WT mouse at clinical endpoint (left panel) and the lung field of a KRAS LSL-G12D/WT ; eIF4A2 fl/fl mouse taken 375 days following Ad5-SPC-CRE administration that had not displayed clinical signs of lung cancer. The statistical test for the Kaplan-Maier analysis in is Logrank (Mantel-Cox) and cohort sizes were N=7 individual mice for eIF4A2 wt/wt (WT) and N=14 for eIF4A2 fl/fl . Only 9 of the 14 mice in the eIF4A2 fl/fl cohort had reached clinical endpoint by 375 days following Ad5-SPC-CRE administration when the experiment was terminated. (C) Ad5-SPC-CRE was administered to KM mice. Mice were sacrificed 28 days following and mutant KRAS G12D (blue) and eIF4A2 (green) were visualised in lung slices using immunofluorescence. eIF4A2 expression is increased in KRAS G12D positive cells (white arrows) and reduced in KRAS G12D negative cells (magenta arrows). (D) KM mice that were either eIF4A1/2 WT/WT , eIF4A1 fl/fl or eIF4A2 fl/fl were induced with Ad5-SPC-CRE. Mice were sacrificed 56 days following Ad5-SPC-CRE administration and eIF4A1 and eIF4A2 visualised in the lung using immunohistochemistry.

Article Snippet: Guide RNA (gRNA) sequences targeting Eif4a2 were cloned into a lentiCRISPR vector (Addgene 52961). gRNAs were as follows: eIF4A2 (forward) CACCGGAAGCCCCTCACATTGTTGT; eIF4A2 (reverse) AAACACAACAATGTGAGGGGCTTCC.

Techniques: Immunohistochemistry, Mutagenesis, Immunofluorescence, Expressing

Journal: bioRxiv

Article Title: Increased mRNA translation delays lung adenocarcinoma initiation and exposes a therapeutic vulnerability to MEK inhibitors

doi: 10.1101/2025.03.19.644135

Figure Lengend Snippet: (A) Percentages of eIF4A2 mutations were obtained from cBioportal by querying the TCGA dataset (10953 patients) . eIF4A2 mutations are present in 6% of cancers on average, but in 16.7% of Non-Small-Cell Lung Cancer. The majority of eIF4A2 mutations in NSCLC lead to amplification of the gene. (B) The TCGA dataset was used to interrogate the overall survival of patients with NSCLC which do (red, n=642) and do not (blue, n=10318) display mutation of the eIF4A2 gene. Patients with NSCLCs harbouring mutations in eIF4A2 exhibit poorer overall survival. The statistical test for the Kaplan-Maier analysis in is Logrank (Mantel-Cox).

Article Snippet: Guide RNA (gRNA) sequences targeting Eif4a2 were cloned into a lentiCRISPR vector (Addgene 52961). gRNAs were as follows: eIF4A2 (forward) CACCGGAAGCCCCTCACATTGTTGT; eIF4A2 (reverse) AAACACAACAATGTGAGGGGCTTCC.

Techniques: Amplification, Mutagenesis

Journal: bioRxiv

Article Title: Increased mRNA translation delays lung adenocarcinoma initiation and exposes a therapeutic vulnerability to MEK inhibitors

doi: 10.1101/2025.03.19.644135

Figure Lengend Snippet: (A-B) KRAS LSL-G12D/WT ; Rosa26 LSL-MYC/LSL-MYC (KM) mice were induced intranasally with Ad5-SPC-CRE. Lung tumours were resected from these mice and cell lines established from these (KM cells). KM cells were transduced with lentiviral vectors bearing guide RNAs recognising non-targeting sequences (NTC) or sequences in eIF4A2 (4A2cr), and eIF4A2 expression in the resulting KM NTC and KM 4A2cr cells was determined by Western blot using GAPDH as loading control (B). (C, D) KM NTC or KM 4A2cr cells were plated at low density onto plastic dishes in serum containing medium (C) or into low adhesion wells in serum-free medium (D). The resulting number of colonies (C) and tumour spheres (D) respectively were then determined. Bars are mean ± SEM, N=3 individual experiments, statistical test is unpaired t-test. (E - J) KM NTC or KM 4A2cr cells were plated onto plastic surfaces and allowed to grow for 48 hr. p21 expression (E), area of the Golgi (F; RCAS1 is a cis-Golgi marker), nuclear area (G) and β-galactosidase activity (H), were visualised and quantified using immunofluorescence. Graph bars are mean ± SEM of N=3-5 individual experiments, statistical test is unpaired t-test. Oxygen consumption rate (I; OCR) and cellular reactive oxygen species (J: cell rox) were determined using Seahorse XF analysis and the CellROX reagent respectively. Graph in I is representative of n=3 individual experiments. Bars represent mean ± SEM of 5 technical replicates analyzed by unpaired t-test. Graph in J is mean ± SEM of N=6 independent experiments analyzed by linear regression, (K, L) KM NTC or KM 4A2cr cells were grown for 48 hr on plastic dishes and lysates subjected to ribosome footprinting analysis in which the regions of mRNA which were protected from nuclease digestion by ribosome occupancy were sequenced. Volcano plot shows and increased number of ribosome-protected fragments (RPFs) in KM 4A2cr (positive log2FC values) than in KM NTC (negative log2FC values). The heatmap displays categories of RPFs significantly enriched (red indicates positive normalised enrichment score (NES)) or depleted (blue indicates negative NES) in KM 4A2cr cells categorised using the ‘hallmarks’ (left column) and ‘gene ontology biological process’ (right column) tools. Data was obtained from N=4 individual experiments.

Article Snippet: Guide RNA (gRNA) sequences targeting Eif4a2 were cloned into a lentiCRISPR vector (Addgene 52961). gRNAs were as follows: eIF4A2 (forward) CACCGGAAGCCCCTCACATTGTTGT; eIF4A2 (reverse) AAACACAACAATGTGAGGGGCTTCC.

Techniques: Transduction, Expressing, Western Blot, Control, Marker, Activity Assay, Immunofluorescence, Footprinting

Journal: bioRxiv

Article Title: Increased mRNA translation delays lung adenocarcinoma initiation and exposes a therapeutic vulnerability to MEK inhibitors

doi: 10.1101/2025.03.19.644135

Figure Lengend Snippet: (A) KM NTC or KM 4A2cr cells were plated onto six-well dishes and allowed to adhere overnight. Adherent cells were incubated at 37°C for 24 hr in the presence and absence of rapamycin (1 μM) or vehicle control (Veh.), medium was then aspirated, and levels of the indicated metabolites in the conditioned medium were determined using LC-MS-based metabolomics. Data are expressed as the fold-change difference between metabolite peak areas detected in cell-conditioned medium and those in medium incubated at 37°C in the absence of cells (normalised to KM NTC cells). Thus, positive and negative values indicate production/release and consumption respectively during the 24 hr period. Bars are mean ± SEM, N=5 (Veh.) and N=4 (Rapa.) individual experiments. (B) KM NTC or KM 4A2cr cells were allowed to adhere overnight and then treated with rapamycin (1 μM), efT226 (1 μM) or vehicle control (Veh.) as indicated for 1 hr. The oxygen consumption rate (OCR) was then determined using Seahorse XF analysis. Bars are mean ± SEM, n=7 (Veh.), n=4 (Rapa.) and n=7 (efT226) technical replicates. Graphs are representative of N=3 individual experiments. (F-H) KRAS LSL-G12D/WT ; Rosa26 LSL-MYC/LSL-MYC (KM) mice that were either eIF4A2 WT/WT , or eIF4A2 fl/fl were induced with Ad5-SPC-CRE as for . Rapamycin (10mg/kg) or vehicle control was administered daily (by i.p. injection) for a 3-week period from either 7 (C) or 62 (G) days following Ad5-SPC-CRE administration. Mice were sacrificed 84 days following Ad5-SPC-CRE administration, and lungs were removed and fixed (E, F, H) . In (D) , KM mice carrying Hprt LSL-iRFP allele were used, rapamycin administered as for (C) and monitoring was by whole body iRFP imaging. Graph represents mean ± SEM of 2 individual mice per condition analysed by linear regression. Lung tumour burden was determined by H&E staining (E, H) and p21 visualised and quantified using immunohistochemistry (F) . Bars are mean ± SEM, each dot represents an individual mouse, statistical test is one-way ANOVA. In the right graph of (E) , bars are mean ± SEM of individual tumours (represented by dots) from N=3 mice per group (each mouse tumours are colour coded in the graph), statistical test is unpaired t-test.

Article Snippet: Guide RNA (gRNA) sequences targeting Eif4a2 were cloned into a lentiCRISPR vector (Addgene 52961). gRNAs were as follows: eIF4A2 (forward) CACCGGAAGCCCCTCACATTGTTGT; eIF4A2 (reverse) AAACACAACAATGTGAGGGGCTTCC.

Techniques: Incubation, Control, Liquid Chromatography with Mass Spectroscopy, Injection, Imaging, Staining, Immunohistochemistry

Journal: bioRxiv

Article Title: Increased mRNA translation delays lung adenocarcinoma initiation and exposes a therapeutic vulnerability to MEK inhibitors

doi: 10.1101/2025.03.19.644135

Figure Lengend Snippet: (A-D) Ad5-SPC-CRE was administered intranasally to KRAS LSL-G12D/WT ; Rosa26 LSL-MYC/LSL-MYC (KM) mice that were either eIF4A2 WT/WT , or eIF4A2 fl/fl . Mice were sacrificed at clinical endpoint and lungs removed and fixed and stained for eIF4A1, eIF4A2 (A) or phospho-ERK (D) using immunohistochemistry. For (B) and (C) mice were sacrificed at 56 days post induction or clinical endpoint and stained for the proliferative marker Ki67. (E) A NSCLC study (1053 patients) from Pan Cancer Atlas was queried in c-Bioportal for RNA expression of eIF4A2, PI3K and ERK1 (MAPK3). Graphs show Pearson and Spearman correlations of eIF4A2 with either PI3K (positive correlation) or ERK1 (negative correlation).

Article Snippet: Guide RNA (gRNA) sequences targeting Eif4a2 were cloned into a lentiCRISPR vector (Addgene 52961). gRNAs were as follows: eIF4A2 (forward) CACCGGAAGCCCCTCACATTGTTGT; eIF4A2 (reverse) AAACACAACAATGTGAGGGGCTTCC.

Techniques: Staining, Immunohistochemistry, Marker, RNA Expression

Journal: bioRxiv

Article Title: Increased mRNA translation delays lung adenocarcinoma initiation and exposes a therapeutic vulnerability to MEK inhibitors

doi: 10.1101/2025.03.19.644135

Figure Lengend Snippet: (A-B) KRAS LSL-G12D/WT ; Rosa26 LSL-MYC/LSL-MYC (KM) mice that were either eIF4A2 WT/WT , or eIF4A2 fl/fl were induced with Ad5-SPC-CRE as for . Lungs were removed at clinical endpoint, formalin-fixed/paraffin-embedded (FFPE) and sectioned. Consecutive serial sections were subjected to multiplex imaging using antibodies recognising eIF4A1, eIF4A2, cytokeratins (pan-CK) and nuclear staining (DAPI) (#1) or spatial transcriptomics hybridisation with pan-CK and nuclear staining (SYTO13) to enable alignment (#2). The transcriptomic signatures in regions of interest (ROIs) representing the eIF4A2-negative tumours of eIF4A2 fl/fl mice and the eIF4A2-positive tumours of eIF4A2 WT/WT mice were then compared (B) . The heatmap displays the ‘hallmark’ gene expression signatures that were upregulated (red) and downregulated (blue) in eIF4A2-negative tumours (B) . (C-D) Tumours were resected at clinical endpoint from KM mice that were either eIF4A2 WT/WT , or eIF4A2 fl/fl and cell lines established from these were termed KM A2+/+ and KM A2−/− respectively (C) . Activity of MAP- and PI-3 kinase signalling in KM A2+/+ and KM A2−/− cells was then assessed using Western blotting with antibodies recognising phospho-ERK and phospho-AKT (D) . β-actin was used as a loading control for eIF4A2 and total ERK as a loading control for pERK and pAKT. (E-F) Levels of eIF4A1, eIF4A2, phospho-ERK and phospho-AKT were quantified using multiplex immunofluorescence in tumour cores from the Lattice-A cohort of human lung cancer. The graphs indicate the relationships between the ratio of MAP- to PI-3 kinase signalling (phospho-ERK/phospho-AKT) expressed as a function of levels of eIF4A1 (left graph) or eIF4A2 (right graph) (E) . Each blue dot represents an individual tumour core (N=994 patients, 3 cores/patient) and the dotted line denotes analysis by linear regression, regression coefficients and p-values are displayed. Representative examples of tumour cores exhibiting high and low eIF4A2 levels and corresponding phospho-ERK and phospho-AKT expression are displayed (F) .

Article Snippet: Guide RNA (gRNA) sequences targeting Eif4a2 were cloned into a lentiCRISPR vector (Addgene 52961). gRNAs were as follows: eIF4A2 (forward) CACCGGAAGCCCCTCACATTGTTGT; eIF4A2 (reverse) AAACACAACAATGTGAGGGGCTTCC.

Techniques: Formalin-fixed Paraffin-Embedded, Multiplex Assay, Imaging, Staining, Hybridization, Gene Expression, Activity Assay, Western Blot, Control, Immunofluorescence, Expressing

Journal: bioRxiv

Article Title: Increased mRNA translation delays lung adenocarcinoma initiation and exposes a therapeutic vulnerability to MEK inhibitors

doi: 10.1101/2025.03.19.644135

Figure Lengend Snippet: (A-B) KM 2A+/+ or KM 2A−/− cells were plated in the presence or absence of Trametinib (Tram.; 100 nM) or vehicle control (Veh.) and cell growth monitored over a 48 hr period (A) . Cell confluence was determined 48 hr following plating (B) , Graphs represent mean ± SEM, N=3 individual experiments. Statistical tests are linear regression in (A) and one way ANOVA in (B) . (C-E) KRAS LSL-G12D/WT ; Rosa26 LSL-MYC/LSL-MYC (KM) mice that were either eIF4A2 WT/WT , or eIF4A2 fl/fl were induced with Ad5-SPC-CRE as for . Trametinib (1mg/kg) or vehicle control was administered daily (by i.p. injection) from 28 days following Ad5-SPC-CRE administration. Mice were sacrificed 84 days following Ad5-SPC-CRE administration, and lungs were removed and fixed. Lung tumour number was determined by H&E staining (D) and phospho-ERK visualised by immunohistochemistry (E) . Values are mean ± SEM, each dot represents an individual mouse, statistical test is unpaired t-test.

Article Snippet: Guide RNA (gRNA) sequences targeting Eif4a2 were cloned into a lentiCRISPR vector (Addgene 52961). gRNAs were as follows: eIF4A2 (forward) CACCGGAAGCCCCTCACATTGTTGT; eIF4A2 (reverse) AAACACAACAATGTGAGGGGCTTCC.

Techniques: Control, Injection, Staining, Immunohistochemistry